Review



bio rad cfx connect real time pcr detection system  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    Bio-Rad bio rad cfx connect real time pcr detection system
    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad <t>CFX</t> <t>Connect</t> <t>Real-Time</t> <t>PCR</t> Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .
    Bio Rad Cfx Connect Real Time Pcr Detection System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 4019 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bio+rad+cfx/CFX+Maestro+Software/pmc12930076-116-7-7
    Average 98 stars, based on 4019 article reviews
    bio rad cfx connect real time pcr detection system - by Bioz Stars, 2026-10
    98/100 stars

    Images

    1) Product Images from "Screening for novel chemical scaffolds targeting PCNA identifies the Hsp90alpha inhibitor SNX-2112"

    Article Title: Screening for novel chemical scaffolds targeting PCNA identifies the Hsp90alpha inhibitor SNX-2112

    Journal: Current Research in Structural Biology

    doi: 10.1016/j.crstbi.2026.100183

    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad CFX Connect Real-Time PCR Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .
    Figure Legend Snippet: PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad CFX Connect Real-Time PCR Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .

    Techniques Used: Thermal Shift Assay, Control, Real-time Polymerase Chain Reaction, Concentration Assay, Recombinant, Purification, Fluorescence, Negative Control, Produced, Maestro Software

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Antibiotic resistance genes detected in lichens: insights from Cladonia stellaris.
    Article Snippet: .. We conducted qPCR analyses using a Bio-Rad CFX-384 193 TouchTM Real-Time PCR Detection System (Bio-Rad, Montreal, CA) under the following 194 thermoprotocol: 95 °C for 3 min; followed by 40 cycles of 95 °C for 20 s and 62 °C for 1 min. 195 Results were validated only if the accompanying standard curves showed efficiency values 196 between 90% and 110%. .. 197 We employed the SmartChip Real-Time PCR System (Takara Bio USA, Inc.) to screen 198 for the presence of ARGs and MRGs.

    Article Title: Investigation into the sensitivity of adipocytes mediated by the major vault protein (MVP) to chemotherapy for triple-negative breast cancer
    Article Snippet: To quantify messenger RNA (mRNA), complementary DNA was prepared using the PrimeScript TM RT Reagent Kit (Takara). .. Real-time PCR was performed on a Bio-Rad CFX-96 Real-Time System (Bio-Rad) with SYBR Green (Bio-Rad) as the fluorescent dye. ..

    Article Title: Identification and functional characterization of an AMD associated c-ABL binding SNP streak within the ARMS2 gene promoter region
    Article Snippet: Complementary DNA (cDNA) was synthesized from total RNA using either the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) or the iScriptTM cDNA Synthesis Kit (Bio-Rad). .. Quantitative PCR (qPCR) was performed using iTaq Universal SYBR Green Supermix (Bio-Rad) or SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) on a Bio-Rad CFX-384 Real-Time PCR system. ..

    SYBR Green Assay:

    Article Title: Investigation into the sensitivity of adipocytes mediated by the major vault protein (MVP) to chemotherapy for triple-negative breast cancer
    Article Snippet: To quantify messenger RNA (mRNA), complementary DNA was prepared using the PrimeScript TM RT Reagent Kit (Takara). .. Real-time PCR was performed on a Bio-Rad CFX-96 Real-Time System (Bio-Rad) with SYBR Green (Bio-Rad) as the fluorescent dye. ..

    Article Title: Albumin-binding dendrimer-conjugated siRNA enables safe and effective gene silencing throughout the central nervous system
    Article Snippet: RNA was extracted using RNA Clean & Concentrator Kit (Zymo Research, Cat. #R1016) and quantified on a Nanodrop (ThermoFisher Scientific). .. For reverse transcription, 1 μg of RNA was used with the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Cat. #4368813) per the manufacturer’s protocol. qRT-PCR was carried out in technical duplicates using iTaq Universal SYBR Green Supermix (Bio-Rad, Cat. #1725122) on Bio-Rad CFX-96 real time machine using gene-specific primers from Integrated DNA Technologies (IDT, Coralville, Iowa, USA): Gfap forward primer: 5’ GTTAAGCTAGCCCTGGACATC 3’; Gfap reverse primer: GATCTGGAGGTTGGAGAAAGTC; Iba1 forward primer: 5’ TCCGAGGAGACGTTCAGTTA 3’; Iba1 reverse primer: 5’ GTTGGCTTCTGGTGTTCTTTG 3’; Gapdh forward primer: 5’ ACAAGATGGTGAAGGTCGGTG 3’; Gapdh reverse primer: 5’ ACCATGTAGTTGAGGTCAATGAAGG 3’. ..

    Article Title: Very long chain sphingolipids govern brain myelination by regulating oligodendrocyte differentiation and membrane microdomain integrity.
    Article Snippet: Data processing and mass image reconstruction were conducted with IMAGEREVEALTM MS (Shimadzu). qRT-PCR Total RNAs were extracted from brain using total RNA extraction kit (TIANGEN, Cat No: DP419) and cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad, Cat No 1708891). .. The quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using the SYBR Green PCR kit (Bio-Rad, Cat No 1725120) on a Bio-Rad CFX Connect 384-Real-Time PCR Detection machine. ..

    Article Title: Identification and functional characterization of an AMD associated c-ABL binding SNP streak within the ARMS2 gene promoter region
    Article Snippet: Complementary DNA (cDNA) was synthesized from total RNA using either the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) or the iScriptTM cDNA Synthesis Kit (Bio-Rad). .. Quantitative PCR (qPCR) was performed using iTaq Universal SYBR Green Supermix (Bio-Rad) or SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) on a Bio-Rad CFX-384 Real-Time PCR system. ..

    Article Title: Very long chain sphingolipids govern brain myelination by regulating oligodendrocyte differentiation and membrane microdomain integrity
    Article Snippet: Total RNAs were extracted from brain using total RNA extraction kit (TIANGEN, Cat No: DP419) and cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad, Cat No 1725120). .. The quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using the SYBR Green PCR kit (Bio-Rad, Cat No 1708891) on a Bio-Rad CFX Connect 384-Real-Time PCR Detection machine. ..

    Quantitative RT-PCR:

    Article Title: Design of bifunctional RNA-binding compounds that can modulate siRNA hydrophobicity for deep penetration and gene silencing in the retina
    Article Snippet: One microliter of siRNA fraction solution (from supernation or pellet) was aliquoted for stemloop reverse transcription (MR101, Vazyme), followed by real-time qPCR quantification using the AceQ qPCR Probe Master Mix (Vazyme, Q112). .. RT-qPCR was performed on a Bio-Rad CFX Connect and analyzed using Bio-Rad CFX maestro software. .. The extraction of total cellular RNA from ARPE-19 was performed using the TRIzol Reagent (Vazyme, R411) according to the manufacturer’s protocol.

    Article Title: Albumin-binding dendrimer-conjugated siRNA enables safe and effective gene silencing throughout the central nervous system
    Article Snippet: RNA was extracted using RNA Clean & Concentrator Kit (Zymo Research, Cat. #R1016) and quantified on a Nanodrop (ThermoFisher Scientific). .. For reverse transcription, 1 μg of RNA was used with the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Cat. #4368813) per the manufacturer’s protocol. qRT-PCR was carried out in technical duplicates using iTaq Universal SYBR Green Supermix (Bio-Rad, Cat. #1725122) on Bio-Rad CFX-96 real time machine using gene-specific primers from Integrated DNA Technologies (IDT, Coralville, Iowa, USA): Gfap forward primer: 5’ GTTAAGCTAGCCCTGGACATC 3’; Gfap reverse primer: GATCTGGAGGTTGGAGAAAGTC; Iba1 forward primer: 5’ TCCGAGGAGACGTTCAGTTA 3’; Iba1 reverse primer: 5’ GTTGGCTTCTGGTGTTCTTTG 3’; Gapdh forward primer: 5’ ACAAGATGGTGAAGGTCGGTG 3’; Gapdh reverse primer: 5’ ACCATGTAGTTGAGGTCAATGAAGG 3’. ..

    Maestro Software:

    Article Title: Design of bifunctional RNA-binding compounds that can modulate siRNA hydrophobicity for deep penetration and gene silencing in the retina
    Article Snippet: One microliter of siRNA fraction solution (from supernation or pellet) was aliquoted for stemloop reverse transcription (MR101, Vazyme), followed by real-time qPCR quantification using the AceQ qPCR Probe Master Mix (Vazyme, Q112). .. RT-qPCR was performed on a Bio-Rad CFX Connect and analyzed using Bio-Rad CFX maestro software. .. The extraction of total cellular RNA from ARPE-19 was performed using the TRIzol Reagent (Vazyme, R411) according to the manufacturer’s protocol.

    Reverse Transcription:

    Article Title: Albumin-binding dendrimer-conjugated siRNA enables safe and effective gene silencing throughout the central nervous system
    Article Snippet: RNA was extracted using RNA Clean & Concentrator Kit (Zymo Research, Cat. #R1016) and quantified on a Nanodrop (ThermoFisher Scientific). .. For reverse transcription, 1 μg of RNA was used with the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Cat. #4368813) per the manufacturer’s protocol. qRT-PCR was carried out in technical duplicates using iTaq Universal SYBR Green Supermix (Bio-Rad, Cat. #1725122) on Bio-Rad CFX-96 real time machine using gene-specific primers from Integrated DNA Technologies (IDT, Coralville, Iowa, USA): Gfap forward primer: 5’ GTTAAGCTAGCCCTGGACATC 3’; Gfap reverse primer: GATCTGGAGGTTGGAGAAAGTC; Iba1 forward primer: 5’ TCCGAGGAGACGTTCAGTTA 3’; Iba1 reverse primer: 5’ GTTGGCTTCTGGTGTTCTTTG 3’; Gapdh forward primer: 5’ ACAAGATGGTGAAGGTCGGTG 3’; Gapdh reverse primer: 5’ ACCATGTAGTTGAGGTCAATGAAGG 3’. ..

    Article Title: Very long chain sphingolipids govern brain myelination by regulating oligodendrocyte differentiation and membrane microdomain integrity.
    Article Snippet: Data processing and mass image reconstruction were conducted with IMAGEREVEALTM MS (Shimadzu). qRT-PCR Total RNAs were extracted from brain using total RNA extraction kit (TIANGEN, Cat No: DP419) and cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad, Cat No 1708891). .. The quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using the SYBR Green PCR kit (Bio-Rad, Cat No 1725120) on a Bio-Rad CFX Connect 384-Real-Time PCR Detection machine. ..

    Article Title: Very long chain sphingolipids govern brain myelination by regulating oligodendrocyte differentiation and membrane microdomain integrity
    Article Snippet: Total RNAs were extracted from brain using total RNA extraction kit (TIANGEN, Cat No: DP419) and cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad, Cat No 1725120). .. The quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using the SYBR Green PCR kit (Bio-Rad, Cat No 1708891) on a Bio-Rad CFX Connect 384-Real-Time PCR Detection machine. ..

    Polymerase Chain Reaction:

    Article Title: Very long chain sphingolipids govern brain myelination by regulating oligodendrocyte differentiation and membrane microdomain integrity.
    Article Snippet: Data processing and mass image reconstruction were conducted with IMAGEREVEALTM MS (Shimadzu). qRT-PCR Total RNAs were extracted from brain using total RNA extraction kit (TIANGEN, Cat No: DP419) and cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad, Cat No 1708891). .. The quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using the SYBR Green PCR kit (Bio-Rad, Cat No 1725120) on a Bio-Rad CFX Connect 384-Real-Time PCR Detection machine. ..

    Article Title: Microbiome of the Proximal Small Intestine in Patients with Acute Pancreatitis.
    Article Snippet: A second round of amplification was performed using standard Illumina indexing primers with adapters. .. Both rounds of PCR were performed using PCR buffer (Eurogen, Moscow, Russia) and a Bio-Rad CFX-96 thermal cycler (Bio-Rad, Hercules, CA, USA). ..

    Article Title: Very long chain sphingolipids govern brain myelination by regulating oligodendrocyte differentiation and membrane microdomain integrity
    Article Snippet: Total RNAs were extracted from brain using total RNA extraction kit (TIANGEN, Cat No: DP419) and cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad, Cat No 1725120). .. The quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using the SYBR Green PCR kit (Bio-Rad, Cat No 1708891) on a Bio-Rad CFX Connect 384-Real-Time PCR Detection machine. ..



    Similar Products

    98
    Bio-Rad bio rad cfx connect real time pcr detection system
    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad <t>CFX</t> <t>Connect</t> <t>Real-Time</t> <t>PCR</t> Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .
    Bio Rad Cfx Connect Real Time Pcr Detection System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bio+rad+cfx/CFX+Maestro+Software/pmc12930076-116-7-7
    Average 98 stars, based on 1 article reviews
    bio rad cfx connect real time pcr detection system - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    98
    Bio-Rad bio rad cfx manager software
    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad <t>CFX</t> <t>Connect</t> <t>Real-Time</t> <t>PCR</t> Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .
    Bio Rad Cfx Manager Software, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bio+rad+cfx/CFX+Manager+Software/pmc13090148-106-2-2
    Average 98 stars, based on 1 article reviews
    bio rad cfx manager software - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    98
    Bio-Rad bio rad cfx maestro software
    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad <t>CFX</t> <t>Connect</t> <t>Real-Time</t> <t>PCR</t> Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .
    Bio Rad Cfx Maestro Software, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bio+rad+cfx/CFX+Maestro+Software/pmc13139853-228-6-6
    Average 98 stars, based on 1 article reviews
    bio rad cfx maestro software - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    96
    Bio-Rad bio rad cfx maestro computer program
    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad <t>CFX</t> <t>Connect</t> <t>Real-Time</t> <t>PCR</t> Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .
    Bio Rad Cfx Maestro Computer Program, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bio+rad+cfx/Computer/pmc13183233-86-26-26
    Average 96 stars, based on 1 article reviews
    bio rad cfx maestro computer program - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    99
    Bio-Rad cfx connect real time pcr detection system bio rad
    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad <t>CFX</t> <t>Connect</t> <t>Real-Time</t> <t>PCR</t> Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .
    Cfx Connect Real Time Pcr Detection System Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bio+rad+cfx/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc13181333-187-14-20
    Average 99 stars, based on 1 article reviews
    cfx connect real time pcr detection system bio rad - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad bio rad cfx96 touch real time pcr detection system
    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad <t>CFX</t> <t>Connect</t> <t>Real-Time</t> <t>PCR</t> Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .
    Bio Rad Cfx96 Touch Real Time Pcr Detection System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bio+rad+cfx/CFX96+Touch/pmc13181061-297-7-14
    Average 99 stars, based on 1 article reviews
    bio rad cfx96 touch real time pcr detection system - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad bio rad cfx connect real time pcr system
    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad <t>CFX</t> <t>Connect</t> <t>Real-Time</t> <t>PCR</t> Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .
    Bio Rad Cfx Connect Real Time Pcr System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bio+rad+cfx/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pm42143128-178-9-9
    Average 99 stars, based on 1 article reviews
    bio rad cfx connect real time pcr system - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    98
    Bio-Rad bio rad cfx manager software v3 1
    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad <t>CFX</t> <t>Connect</t> <t>Real-Time</t> <t>PCR</t> Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .
    Bio Rad Cfx Manager Software V3 1, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bio+rad+cfx/CFX+Manager+Software/pmc13170648-123-13-13
    Average 98 stars, based on 1 article reviews
    bio rad cfx manager software v3 1 - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    Image Search Results


    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad CFX Connect Real-Time PCR Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .

    Journal: Current Research in Structural Biology

    Article Title: Screening for novel chemical scaffolds targeting PCNA identifies the Hsp90alpha inhibitor SNX-2112

    doi: 10.1016/j.crstbi.2026.100183

    Figure Lengend Snippet: PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad CFX Connect Real-Time PCR Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .

    Article Snippet: Thermal shift assays were performed using a Bio-Rad CFX Connect Real-Time PCR Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM.

    Techniques: Thermal Shift Assay, Control, Real-time Polymerase Chain Reaction, Concentration Assay, Recombinant, Purification, Fluorescence, Negative Control, Produced, Maestro Software